We've Moved! Visit our NEW FORUM to join the latest discussions. This is an archive of our previous conversations...

You can find the login page for the old forum here.
CHATPRIVACYDONATELOGINREGISTER
DMT-Nexus
FAQWIKIHEALTH & SAFETYARTATTITUDEACTIVE TOPICS
123NEXT»
Genetically engineered DMT Options
 
crystalizer
#1 Posted : 5/18/2011 11:01:31 AM

DMT-Nexus member


Posts: 43
Joined: 01-Apr-2011
Last visit: 25-Apr-2020
Location: Germany
[Finally promoted - and I hope I won't make any chemist angry for posting in this section - but here it is pretty scientific]

Does anybody know whether anyone tried to genetically engineer DMT? Any literature? I just want to get through with this topic theoretically, no intend to break laws.

Why I am asking... The theoretic synthetic route, lets say suggested in THIKAl (#6) is quite a little work, and Im not completle sure whether methyl iodine is a controlled substance? Furthermore yield is "minuuscule" when not putting more work into it.

Whatsoever, looking from a point of a biologist... the two key enzymes are present in every organism. Different sources of the key enzymes (AADC, INMT) are annotated, thus cloning them is in generall no problem. There would be some problems in primer design, as the primer sequences are prone to selfligation (depending on donor). Nevertheless lets say one of the key enzymes has been cloned, subcloned and placed in the pQE-80L in frame. Result would be: nnDMT in very low ammounts by expression in E. coli. Interesting would be, if the product is present extracellular.
But it can not be excluded that a crosscontamination took place, as the extraction was only a screening extraction, thus there might been used a vessel which contained already minor ammounts of DMT from prior MHRB extraction. So the experiments would be repeated.
E. coli would have been fed with l-tryptophane, so any chemist can explain what happens to l-tryptophane when present in the media, lets say going with a STB extraction? I mean the amino acid would only change charge at high pH?

Using an microorganism as DNA donor, one could always also check the primers with Jurema preta (Mimosa hostilis) in PCR. Specific primer design for Jurema is not possible, as noone sequenced it, as far as I know.

Further work would include the transcloning of key enzymes in plants, lets say Nicotiana tabacum, whith the aim, to no longer have to "feed" l-tryptophane as plants do it on their own...


Any thoughts, suggestions and theoretical hints?

Of course, the "spirit" of the plantmaterial might be harmed, but as I mentioned all this is theoretical.
"It is not the strongest species that survive, nor the most intelligent, but the ones most responsive to change."
-NOT Darwin
 

STS is a community for people interested in growing, preserving and researching botanical species, particularly those with remarkable therapeutic and/or psychoactive properties.
 
Infundibulum
#2 Posted : 5/18/2011 2:56:43 PM

Kalt und Heiß, Schwarz und Rot, Kürper und Geist, Liebe und Chaos

Chemical expert

Posts: 4661
Joined: 02-Jun-2008
Last visit: 19-Apr-2026
This topic pops every now and then, but if you don't have your molecular biology skills nailed down pretty hard you won't really go that far. FYI, yeast is far better to grow rather than ecoli. yeasts can fold and tolerate eukaryotic proteins better. They also smell far better (ecoli smells like shit, plain and simple). And you can always claim you're brewing beer.

Going to technical details, cloning genes and transforming cells is the lulz part, no difficultly here. But to get a micro-organism expressing these genes, in the appropriate amounts and without creating toxic metabolic by-products you'll have figure things like:

1. where in the genome you're going to stick these genes?
2. you'll need microorganisms (be it ecoli or yeast) that can be selected for during transformations. you might need to do some extra work to generate a strain that will be used for your future transformations.
3. which promoters will you choose to drive their expression? Some are too good, some are too bad, others just right (for each gene)
4. how are you going to ensure genetically modified organism are treated and disposed properly (even from laymen)
5. where will the end-product be? If it's inside the microorganism, it'll be most likely deleterious. And if it's well tolerated, boiling masses of yeast/ecoli bloody stinks like sewers. If it's outside in the medium all is well, but how are you going to do it? Targeting proteins to the secretion pathway is good idea, usually difficult to achieve in practise, but doable. Even in this case where you plan to synth dmt ex-vivo in the growing medium it'll be difficult to make both enzymes to work well. On the other hand, targeting dmt for secretion is another tedious story, almost undoable ATM;.

All in all, not a bad idea such a project takes time (I'd give it 1-2 years to achieve), loads of money and a full-time work on that, realistically.

crystalizer wrote:
...There would be some problems in primer design, as the primer sequences are prone to selfligation (depending on donor).

lol, noobRazz

primer design (for the cloning stuff you propose) is easy as fuck! Smile


Need to calculate between salts and freebases? Click here!
Need to calculate freebase or salt percentage at a given pH? Click here!

 
polytrip
#3 Posted : 5/18/2011 4:06:19 PM
DMT-Nexus member

Senior Member

Posts: 4639
Joined: 16-May-2008
Last visit: 24-Dec-2012
Location: A speck of dust in endless space, like everyone else.
sigh...i guess we have to go back to extracting cat's again.
 
crystalizer
#4 Posted : 5/18/2011 7:12:01 PM

DMT-Nexus member


Posts: 43
Joined: 01-Apr-2011
Last visit: 25-Apr-2020
Location: Germany
First of all, thx for replying Pleased

SO where to begin... yeah, molecular biology and genetic engineering skills are nailed down with a diploma Pleased
A pretty well equipped lab, time and money - guess what Pleased Of course this whole discussion is theoretical, and there is no intend in breaking any laws.

And as you were amused and noobing me - lets go on with primer design. Is not always that easy.
I am working in the field - I have already designed more then 500 primers, so most likely you are the noob, not wanting to offend you. Of course if you are lucky, primer design is straightforward, and easy as fuck, but as already mentioned - it depends always on the sequence you are about to amplify. Don't want to go into detail here, makes no sence to explain to a noob - but lets say complications arise when the sequences are unpleasant.

To answer your "questions", and which might be also interesting for other people and the developing of this topic:

1. The first attemp would not be to alter the organisms genome, it would be by introducing an expression vector (lets say pQE-80L for E.coli) or "own" created vectors...
2. In the beginning the MO which should be used is E. coli as the selection is nice and easy using antibiotic resistance. An additional plus for colis is their growth rate. The generation of special strains would not be neccessary as they are commercialy available Pleased
3. As a starting point, the mentioned pQE-80L contains the T5 promotor - in my opinion a good starting point.
5. End product would be in media. But again as mentioned before experiments should be repeated. The ex-vivo option is not considered - as you already mentioned - the work of two enzymes in one environment is most unlikely. Trying it ex-vivo is almost the same as syntheseizing it.

"SUMMARY" 1,2,3,5:

Yeast (lets say Saccharomyces cerevisiae) should be excluded for the beginning: considered fungi the selection would not take place over antibiotics, MY fovourite selection method. Of course when it is not working in E. coli yeast would be the optional route, especially - as you already mentioned - the concerns with correct protein folding. Oh and by the way, colis and yeast have a pleasant smell in comparision with other smelly MOs ... In the beginning no "sticking genes into genomes" should take place. Only expression vectors should be used. The mentioned expression vector has additional His-tags, so further analytical advantages Pleased



4. Yeah, the disposal. In my opinion its bullshit. Considering the usage of expression vectors, the colis will "kick" them out if there is not a pressure to keep them (speaking of antibiotics). That makes them almost the same everyone shits out every day. Nevertheless looking at regulations, of course the correct way is to kill them. There are many options, from using a pressure cooker, an oven at at lets say 150°C ar just as usual an autoclave.


The different resulting metabolites must be analyzed. First seperated by TLC and afterwards further investigated via GC-MS, HPLC and if that does not help by our fractioning friend the QTOF-MS.

[ LOL - Just a tought, imagine it works . colonize GMOs in your intestine . only thing you need: MAOI ]
"It is not the strongest species that survive, nor the most intelligent, but the ones most responsive to change."
-NOT Darwin
 
Infundibulum
#5 Posted : 5/18/2011 8:50:30 PM

Kalt und Heiß, Schwarz und Rot, Kürper und Geist, Liebe und Chaos

Chemical expert

Posts: 4661
Joined: 02-Jun-2008
Last visit: 19-Apr-2026
Nah, you prolly can make it work with vectors in ecoli but this is too flimsy and hald-assed... maybe worth trying as a proof of principle but I wouldn't put my money and effort on this route. Depends on what you want finally achieve though, that is do you want to do MO for your joy (where you can grown ecolis with your lab antibiotics and lab media) or you look for something for the bigger audience (i.e. useful and easily usable for the community). I'm for the latter, hence I vouch for the yeast and genomic integrations.

BTW, you're the first to claim ecoli smells nice, to everyone i've met it really does not compare with the bready sweet smell of yeast.


Need to calculate between salts and freebases? Click here!
Need to calculate freebase or salt percentage at a given pH? Click here!

 
Newfound_wonder
#6 Posted : 5/18/2011 10:36:52 PM

Harvie Krumpet


Posts: 123
Joined: 06-Sep-2010
Last visit: 20-Nov-2015
Location: Cherub Rock
If you could sequence, clone, and express the genes involved in DMT biosynthesis, could you produce a stockpile of each enzyme and synthesize DMT from L-tryptophan via enzymatic processing?
Every tool is dangerous when misused. That is no reason not to use tools.
Isn't it strange that a gift can be an enemy?
 
Xt
#7 Posted : 5/18/2011 10:45:01 PM

.

Senior Member

Posts: 981
Joined: 24-Dec-2009
Last visit: 13-Oct-2022
How is this topic not locked?

“Right here and now, one quanta away, there is raging a universe of active intelligence that is transhuman, hyperdimensional, and extremely alien... What is driving religious feeling today is a wish for contact with this other universe.”
― Terence McKenna
 
endlessness
#8 Posted : 5/18/2011 10:53:27 PM

DMT-Nexus member

Moderator

Posts: 14191
Joined: 19-Feb-2008
Last visit: 22-Sep-2026
Location: Jungle
because its not suggesting any process that the common person would attempt like synthesis with dangerous products I guess.. Im just sitting here and watching as experts speak some interesting things that are beyond my reach, I dont think this will lead to anybody kabooming themselves like a talk of a seemingly-doable synthesis with watched or dangerous products would. Do you?
 
joedirt
#9 Posted : 5/19/2011 12:01:01 AM

Not I

Senior Member

Posts: 2007
Joined: 30-Aug-2010
Last visit: 23-Sep-2019
If you can construct a plasmid with the INMT gene in it you would be able to open a up a whole world of bacterial expression vectors.... Once you had good colony growing with you INMT plasmid you could feed a substrate spiked with tyrptamine and quite possible declare that you have the holly grail of DMT. hell, you may not even have to spike it. most organisms already have tryptophan decarboxylase enzymes present....

Of course if you do this....if you can... please, please, please at least make sure that a few others in a scientific field have access to the plasmid before you go public with it......in case you didn't notice me in the back of the room flailing my arms around frantically...I'd certainly like to be one of those scientists that have access to a bacterial cell line that could n-methylate tryptamines.

Peace.
If your religion, faith, devotion, or self proclaimed spirituality is not directly leading to an increase in kindness, empathy, compassion and tolerance for others then you have been misled.
 
SWIMfriend
#10 Posted : 5/19/2011 1:49:57 AM

DMT-Nexus member

Senior Member

Posts: 1695
Joined: 04-May-2009
Last visit: 11-Jul-2020
Location: US
I actually have a PhD in molecular biology--but in an area of study totally unrelated to this topic. Overall, I would have to believe that it would be FAR more involved than EITHER outright synthesis (even if you had to work on synthesizing some of the precursors on your own) OR (of course) extracting it from plants.

To begin, you'd want to have some quick and easy (and cheap) assay available for the presence of DMT. I don't think there is one, now, is there? If you had that, you could try for some "thrown it in and hope" transformations, and over time hope to select for a clone that had good production.

If I had a good and simple assay though, I'd instead use it for testing indigenous plants for new extraction targets.

Thinking about such things is MUCH easier than trying to carry it out in the lab--it's a LOT OF WORK!
 
crystalizer
#11 Posted : 5/19/2011 2:23:39 AM

DMT-Nexus member


Posts: 43
Joined: 01-Apr-2011
Last visit: 25-Apr-2020
Location: Germany
Again thx for reading and thinking ! And again, this topic is THEORETICAL. The manufacturing of DMT (including extraction and synthesis) is illegal in most parts of the world.

@XT & @endlessness: As mentioned, im just a spirit, so still figuring out my way of exploring the Nexus. My post is certainly NOT suggesting ANY process, which ANY person can do at home. Whithout lots of expensive materials and analytical means (and of course know-how) it is not accomplishable. Furthermore I would never have the idea to administer any of theoretical obtained product to any living thing which includes myself. [Uh, not to mention my studies included GxP in the pharmaceutical industrie.]

I conisider it as a shame that studies on psychedelic substances are an area, which all governments forbid. I am sure, that the military does lots of "top secret" stuff, and they obtained lots of results... but they WON'T share with the public. I see the nexus as a great oppurtunity to share, evaluate and explore the world of psychedelics: it is wrong to forbid them. Education is the key. Nexus is the key. It dosn't matter who you are, a pothead (sorry potheads, i mean it in a positive way) or a crazy scientist - we all want to expand our horizons.

@Newfound_wonder: Theoretically yes. Just get a kg of l-tryptophane, let the first enzyme work, inactivate the first enzyme and let the second do its job. Thats the simple theory, but real life looks different - enzymes need different conditions (including pH, temp....), cofactors etc... furthermore the purification of enzymes in larger quantities is quite tricky. Thats why the theoretical strategy involves in-vivo first.

@Infundubulum: Yeah proof of principle would be great for beginning Pleased Anyways there is no way of spending MY money on this Laughing The effort... well, people put a lot of effort in different kind of (crazy) things, consider it as a hobby of mine Smile. The overall achivement - well considering the tiny tiny quantities of DMT present in natural sources and a long way of chemical synthesis - there should be an alternative way to acess great quantities of DMT, which would be neccessary for lets say reasearch - if one day somehow it should be legalized...
Coming to the smell. Well, I worked with crazy ass bacterial and fungal cultures, THEY REALLY SMELLED LIKE SHIT. Thus I consider colis and yeasts as relative mild. Thinking about it, you are maybe right, havent worked since a long time with yeast, so the actually might smell better. BUT considering smell: when I read, that people extract their DMT with naphtha - geeeeee - my hair stands up like an urchin. I would't even lighten my BBQ with that nasty smelling crap...

@joedirt: As you mentioned aromatic amino acid decarboxylase is present in most organisms... yeah. But the promoter is not strong enough for large scale. AADC is one son of a ...
INMT: easy, done it in a fictional world. In this fictional and theoretical world, the results from expressing the genes and extracting, GS-MS would show quantities of about 5µg nnDMT / mL of bacterial culture. But as mentioned before, experiments need to be repeated. Sometimes I mess up stuff in my fictional world....

@SWIMfriend: Ahhh, nice. Someone wise Smile Yepp, there would be a method for (almost)fast screening. My fastest way is by thin layer chromatography. Obtaining positive results from TLC would bring us to GC-MS. Run takes about 30 minutes (not counting the wash cycles and heating period). Outright synthesis and plant extracts are quite well known, I am looking for a NEW theoretical way. Spending sometimes 70h a week in a lab gives you crazy ideas, you know, all the waiting time in the lab would be a waste of time.
"It is not the strongest species that survive, nor the most intelligent, but the ones most responsive to change."
-NOT Darwin
 
crystalizer
#12 Posted : 5/19/2011 2:33:13 AM

DMT-Nexus member


Posts: 43
Joined: 01-Apr-2011
Last visit: 25-Apr-2020
Location: Germany
Uh I forgot sth.

@the special agent investigating: Come and find me, pay me 500$ an hour, give me a permission and I will do this work for you. Only thinking and making theories makes me sick.

"It is not the strongest species that survive, nor the most intelligent, but the ones most responsive to change."
-NOT Darwin
 
Infundibulum
#13 Posted : 5/19/2011 2:56:38 AM

Kalt und Heiß, Schwarz und Rot, Kürper und Geist, Liebe und Chaos

Chemical expert

Posts: 4661
Joined: 02-Jun-2008
Last visit: 19-Apr-2026
As we're onto the theorising bit, could you create us some primers and suggest a strategy for your hypothetical approach, step-by-step but not too exhaustively?


Need to calculate between salts and freebases? Click here!
Need to calculate freebase or salt percentage at a given pH? Click here!

 
crystalizer
#14 Posted : 5/19/2011 5:39:16 AM

DMT-Nexus member


Posts: 43
Joined: 01-Apr-2011
Last visit: 25-Apr-2020
Location: Germany
Well... quite a bit of work Pleased I'm not sure how far I get now, because I have to get to work ...

1. You would need a source for your DNA, a donor. By searching the ncbi for the key enzymes (you would need to search for all the different synonyms) and filter by organisms, which would be available in your lab.

2. Design primers - yeah thats quite a bit, I can not design you any primers with no ORF. Primer design is "simple as fuck" as I ve learned here in the Nexus. ... But for noobs in short: You need two primers. One forward, one reverse. For the forward you copypaste the lets say first twenty bp from the start point (AUG). Check for equal ammounts of g,c,t,a's. You would add in front of the sequence a restriction recognition site, lets say SacI (GAGCTC). Of course you must check for the SacI within the ORF, because when it is present, that would suck Pleased For beginners its wise to add 2-3 bp more, as polymerases are bastards. Calculate melting temp!
For reverse, copypaste last 20 bp form end, invert them, add other restriction site [e.g PstI(CTGCAG), check for restriction site presence within ORF, add few bp for good luck.

example: ORFX: auggcta....................gctagtg


fw: ct(GAGCTC)auggcta......

rev: CGATCACCTGCAGga

Sorry if Im talking bullshit, but as mentioned before Im in a hurry Pleased


2. Order primers

3. Isolate DNA

4. PCR: 50µl Pfu batch, 37x/mt°C-5°C/(1kb/1.2min)

5. Recover DNA over gelelectrophoresis

6. 20µl Taq batch witn dATPs, "a-tailing" 72°C, 15min

7. Ligate into subvector, e.g. pGEM-Teasy

8. Transform E.coli, let grow overnight

10. Screen via b/w and antibiotic resistance

11. Prepare 2mL cultures of different colonies, let grow over night, dont forget antibiotic

12. Miniprep

13. Control for positive plasmids via restriction double digest, one cut within ORF one in vector

14. If postive, excise ORF from subvector via SacI/PstI, recover fragment of interest via gelelectrophoresis

15. Ligate ORF in expressionvector

16. Transform E. coli. let grow overnight

17. Prepare 2mL cultures for overnight growth (antibiotics!)

18. MAXIprep or very good miniprep, as most expression vectors ar lowcopy plasmids

19. Check via restrictiondigest, when positive prepare glycostocks for permanent storage at -80°C

20. Prepare a 200ml culture with additional 50mg of l-tryptophane of positive colony. Let grow to an OD600 of about 0,5 and induce vector with IPTG and then let grow at 28°C overnight (antibiotics).

21. Extract similar to MHRB, but shorter

22. Run extract over TLC with a DMT reference

23. Run extract over GC-MS with a DMT ref.


@Infundibulum: as mentioned, im in a hurry... off to work now.in this theoretical approach might be errors and you are welcome to correct and ask for further details - but need to wait couple of hours for the answer....hope it is not to exhautively? im not sure how much detail you were expecting
"It is not the strongest species that survive, nor the most intelligent, but the ones most responsive to change."
-NOT Darwin
 
crystalizer
#15 Posted : 5/19/2011 6:00:04 AM

DMT-Nexus member


Posts: 43
Joined: 01-Apr-2011
Last visit: 25-Apr-2020
Location: Germany
While having a shower, i spotted a minor mistake.

I was deep in joedirt's thoughts about AADC being present in most organisms anyways and thus only the cloning of INMT would ne neccessary.

So the correction would be, of course you clone till point 18. both genes in parallel on its own. [LOL, hope you know what I mean]. Thus two different expression vectors looking at the selection marker are neccessary.

When you have both expression vectors confirmed, you would prepare competent cells of one of your GMOs, either the AADC or the INMT strain and transform them with the other one...

Then you can go on with point 19 Pleased


AAAAND now, really off to work Pleased
"It is not the strongest species that survive, nor the most intelligent, but the ones most responsive to change."
-NOT Darwin
 
Infundibulum
#16 Posted : 5/19/2011 6:09:14 AM

Kalt und Heiß, Schwarz und Rot, Kürper und Geist, Liebe und Chaos

Chemical expert

Posts: 4661
Joined: 02-Jun-2008
Last visit: 19-Apr-2026
?????

Well, no really need to get in such an exhaustive detail, it is not necessary. Just design the primers if you got something more meaningful to contribute and outline a strategy. Because I see that you got some ideas but not a plan. You initiate this discussion of transforming cells with DNA to make dmt and you have not even decided what type of DNA you transform them with! Which enzymes? from which organism(s)? why did you choose them? Do you intend to use whole ORF or parts of them?

You see what I mean? We have a really long way to go in the discussion and planning before throwing a bunch of meaningless technical details. Until now it has been just mental masturbation. Do not get lost in the details especially since you surely know that many of these descriptions and numbers do not matter. I really don't care one bit if your pcr is 20 microliters or 33 or if your o/n cultures are 2 or 5 ml and most likely whether your primers self-anneal or whatever is the least of your concerns. your whole post reads as a show off to be honest!





Need to calculate between salts and freebases? Click here!
Need to calculate freebase or salt percentage at a given pH? Click here!

 
crystalizer
#17 Posted : 5/19/2011 6:24:20 AM

DMT-Nexus member


Posts: 43
Joined: 01-Apr-2011
Last visit: 25-Apr-2020
Location: Germany
Was not sure what you wanted... sry for that, misunderstanding.
course ive planned sth out, i thought that you are going to do some fantasy work at your lab, and how do i know what you got in stock...mental masturbation looks different, belive me.

Of course whole ORF.

1) Mesorhizobium loti MAFF303099 chromosome, complete genome
NCBI Reference Sequence: NC_002678.2
LOCUS NC_002678 1554 bp DNA linear BCT 29-JUN-201

mlr4653, aromatic-L-amino-acid decarboxylase

ORIGIN
1 atgccgagga gatggcgctg tcgcgctcga cgcccggcgg ccagttcccg gcggcttgac
61 gggagcccgg tcatggacat cgcgcaggaa accgtcggca ccgaggaaac gctcgacccc
121 gccgactggg ccgcagtgca agccctgtcg caccaggtca tcgacgatgc cgtcgactat
181 ctcagcgaca tcagggaccg cccggcctgg cgcgagatgc cggcggaggt gcgagaagcc
241 ttcgcggcac ctctgccgcg atcgccggtg ccgctggccg ccgtctatga cgaggtctcg
301 cgcacggtga tgtcctatcc gatgggcaac atccatccgc gattctgggc ctggtatatg
361 gggtcgagca acttcaccgg cgcgctcggc gacttcctgg cggcaatcca gggttccaac
421 ctcggcggcg gcaaccacgc cgccgggctg atggacagcc aggtggtcaa ctggtgcaag
481 cagatgctgg gctttccggc ttccgcctcc ggcacgctgg tcagcggcgg ctcgatggcc
541 aacgtgatcg gcctgaccgt ggcgcgcaac gccaaggccg gcatcgacgt gcgcgagcac
601 ggcgtcgcgg cgatcgaaaa gccgctgcgc ttctatggct cggaccagat ccattcctgc
661 caccgcaagg caatggaagc acttggcctc ggcaaccggg cgctgcggcg catcccgacg
721 gatgccgacc tgcgcatcga cataccggcc ttgcgcgcgg cgatcgttga ggaccgcgaa
781 gccggtttca agccggcctg cgtcatcggc aatgccggca cggtcaacac cggcgcgatc
841 gacgatttgc gggcgcttgc caaactcgcg catgaggaag gcctatggtt ccatgtcgat
901 ggctgcatcg gcgcgctgat cgcgatcgcc cccgacaatg cgcatcgcgt tgccggcatc
961 gaatgggcgg attccgtcgc gctcgatccg cacaaatggc tgcatgcccc gttcgaggtc
1021 ggctgcgccc tggtcaggga tgccgtcgcc caccgccgga ccttcgcggt gacgccggaa
1081 tatctggaat cgacgccgcg cggccttgcc tccggcgaat ggctgcacga ttacggcctg
1141 cagacgtcgc gcggctttcg cgcgctgaaa gtctggatgg cgctgaagga acatggtgtc
1201 gacaaattcg gccgcctgat cgaccagaac atcgcgcaag cctcctatct cgccggggtg
1261 gtcgaggccg agccgctgat ggagctggcg acgtcgccga ccatcaacat cgtctgcttc
1321 cgctaccagc ccggcgtcac cggcgaggcg ctgaaggtgc tcaacaccga gatcatgctg
1381 cggctgcagg aacagggcat cgccgtcctt tccgacacta ccgtgcatgg cgaacactgg
1441 ctgcgcgtgg cgatcgccaa ccaccgcaca aggcgcgagg acctcgacct tctggtcgag
1501 gaaacggtgc ggttgggacg tgagatcgca gcagaaggct ccccccggaa atag

fw atGGATCC atgccgagga gatggcgctg
rev atCCCGGG CTATTTCCGGGGGGAGCCTT

reverse primer would suck. not equally distributed. better primer MUST be outside ORF.



2) MO as above, gene="mlr4870", arylamine N-acetyltransferase

ORIGIN
1 atgaacgatg ctcctccctt cgacctcgac gcctatctcg ctcgcatcgg ttacaccggt
61 ccgcgcaacg cgtcgctgga tacgctgaag gcgctgcatt tcgcgcatcc gcaggcgatc
121 cccttcgaga acatcgatcc gtttcttggt cgcccggtcc ggctcgacct tgccgcgctg
181 caggacaaga tcgtccttgg cgggcgcggt ggctactgct tcgaacataa cctgctcttc
241 atgcatgcgc tgaaggcgct tggtttcgag gtcggcgggt tggccgcgcg tgtgctctgg
301 ggccagagcg aggacgccat caccgcgcgc agccacatgc ttttgcgcgt cgagctcgac
361 ggccggacct acatcgccga tgtcggcttc ggcggcctga ccctgaccgc gccgctgctg
421 ctggaaccgg gccgcgaaca gaaaaccccg cacgagcctt tccgcatcgt cgaggccgac
481 gatcatttcc gcctgcaggc cgccatcggc ggcgactggc gctcgctcta ccgcttcgac
541 ctgcagccgc aatacgaagt cgattactcc gtcaccaatt acttcctgtc gaccagcccg
601 acatcgcatt tcctctcctc cgtcatcgcg gcacgcgccg cgccggaccg gcgctacgcg
661 ctgcggggaa accgcttgtc gatccatcac cttggcggcc gcaccgagca gacagagata
721 gccaccgccg ccgaccttgc cgacacgctg caaggcctgc tcggcatcat cattcccgac
781 cgcacggctt tcgaggccaa ggtgcgtgag acgaagatcg tggagaccaa cgcatga


fw atGGATCCatgaacgatg ctcctccctt c
rev atCCCGGG TCATGCGTTGGTCTCCACGATC



"It is not the strongest species that survive, nor the most intelligent, but the ones most responsive to change."
-NOT Darwin
 
crystalizer
#18 Posted : 5/19/2011 6:30:24 AM

DMT-Nexus member


Posts: 43
Joined: 01-Apr-2011
Last visit: 25-Apr-2020
Location: Germany
ARGH. again mistake. ok, forget second ORF. acetyltransferase is not methyltransferase. need to look it up... l8ter
"It is not the strongest species that survive, nor the most intelligent, but the ones most responsive to change."
-NOT Darwin
 
Infundibulum
#19 Posted : 5/19/2011 11:15:22 AM

Kalt und Heiß, Schwarz und Rot, Kürper und Geist, Liebe und Chaos

Chemical expert

Posts: 4661
Joined: 02-Jun-2008
Last visit: 19-Apr-2026
Why do you choose this gene? Which vector is this supposed to be cloned into? Could you do with less sequence?

Your primers suck as they are. they're bad in so many respects. for sure you can do better. also, expressions vectors already have atg and stop codons, no need to include them further. you really do not need to get the whole orf esp if sequence is not ideal for priming (as in this case). Go to the protein sequence and see whether you can trim off amino acids/nucleotides that are not necessary for your needs. a smaller sequence will be easier to handle anyway. Do check protein structures if available. Check genes from other organisms. Might be easier to clone. You need to anyway try proteins from a few different organisms in case your chosen one may work. Check literature. Tryptophan decarboxylase from rice has already been cloned and expressed in both bacteria and yeast and found to be capable of producing tryptamine from tryptophan (PMID: 18776677). Do not re-invent the wheel.

Think about INMT. Where you're gonna get the gene from? More tricky compared to tryptophan decarboxylase.


Need to calculate between salts and freebases? Click here!
Need to calculate freebase or salt percentage at a given pH? Click here!

 
crystalizer
#20 Posted : 5/19/2011 11:13:31 PM

DMT-Nexus member


Posts: 43
Joined: 01-Apr-2011
Last visit: 25-Apr-2020
Location: Germany
@Infundibulum: I really appriciate your efforts! But I'm tiered as F... awake now for about 50h and need a rest. will keep on posting mental masturbations during weekend Razz THX
"It is not the strongest species that survive, nor the most intelligent, but the ones most responsive to change."
-NOT Darwin
 
123NEXT»
 
Users browsing this forum
Guest

DMT-Nexus theme created by The Traveler
This page was generated in 0.131 seconds.