We've Moved! Visit our NEW FORUM to join the latest discussions. This is an archive of our previous conversations...

You can find the login page for the old forum here.
CHATPRIVACYDONATELOGINREGISTER
DMT-Nexus
FAQWIKIHEALTH & SAFETYARTATTITUDEACTIVE TOPICS
what is the deal with genetic engineering? Options
 
imachavel
#1 Posted : 7/13/2008 11:33:57 AM
DMT-Nexus member


Posts: 177
Joined: 02-Apr-2008
Last visit: 28-Feb-2010
Location: Miami, fl
I understand they splice genes at a molecular level


but genes changing in nature take hundreds of thousands of years, right?


it's like if you had an assembly line, and there were 50 billion people working on one assembly line, and 2 people had an idea to take a different screw and put it in the box they're passing down the line, hoping someone will notice it works better than the other screws, but by the time it gets to the end, most likely everyone will just have used the natural sequence they've been using since they started the line, and thrown out the boxes with the different screws, or forgotten that they were putting different screws in the box and put maybe 10 or 40 or 80 or something boxes with different screws in a pile without noticing.
Maybe 800,000 years later, the line will eventually have realized that people were using different screws that worked better from those 10 boxes from 800,000 years ago and kept the sequence and started using it all the way through the assembly line.

the point is, it takes forever for a random genetic modification to be remembered and constantly used in a new sequence of change for a plant, bacteria, animal or other(prokaryote or eukaryote)

that's why when people genetically modify something, they splice the genes. how do they get the genes to allow the genetic modification in the first place? this is the part i never seem to grasp.
 

Live plants. Sustainable, ethically sourced, native American owned.
 
deedle-doo
#2 Posted : 7/13/2008 4:51:02 PM

DMT-Nexus member


Posts: 296
Joined: 25-May-2008
Last visit: 04-Aug-2013
You are asking a fairly deep set of questions that will take a bit of unfolding to address. I will address this in parts so as to not type a giant dull diatribe on molecular genetics. I will also keep it simple and just hit you with the general principles and not the details and exceptions but we can discuss anything you'd like in more detail.

So, lets start with the basics. What is a gene?
Roll this around a bit before reading on so we can properly air out your preconceived misconceptions.



Genes are discreet ordered sequences of DNA. This DNA is a long polymer made of 4 different chemicals which we can symbolize C,G,A and T. These 4 are the letters of the genetic code. All of the information to construct an organism is contained in this genetic alphabet. A gene is a functional unit of the DNA defined by it's sequence of A,T,C and G. The gene has a code for where it starts and ends. DNA is able to replicate so each cell in an organsim and each individual in a population of organism will inherit a full complement of genes.

Now ask yourself: What do genes do exactly? Think about this mechanistically. The easy answer is: Genes are the vehicle of heredity necessary to build and maintain an organism and it's descendants. But what about the mechanism, how do genes work and what do they really do?

Genes code for proteins. Proteins are made from long polymers of amino acids. It takes three DNA letters to code for a protein. This is the genetic code.



So if you wanted a gene that coded for nothing but poly-tryptophan the gene would look like:
AUGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGA
This codes for: START - (tryptophan)x16 - STOP

In general, this is all genes are and this is all genes do. To a first approximation each individual gene codes for an individual unique protein. Proteins actually do the work of shaping and maintaining organism. You are built of and by proteins. One gene, one protein.

Let me know if any of this is unclear. When you grok the basic principles of molecular biology the rest of your question becomes answerable.




 
burnt
#3 Posted : 7/13/2008 11:48:01 PM

DMT-Nexus member

Extreme Chemical expertChemical expertSenior Member

Posts: 3555
Joined: 13-Mar-2008
Last visit: 07-Jul-2024
Location: not here
imacheval haha man you gotta go to become a genetic engineer your always thinking bout this stuff haha its fun. Twisted Evil
 
imachavel
#4 Posted : 7/14/2008 1:23:53 AM
DMT-Nexus member


Posts: 177
Joined: 02-Apr-2008
Last visit: 28-Feb-2010
Location: Miami, fl
deedle-doo wrote:
You are asking a fairly deep set of questions that will take a bit of unfolding to address. I will address this in parts so as to not type a giant dull diatribe on molecular genetics. I will also keep it simple and just hit you with the general principles and not the details and exceptions but we can discuss anything you'd like in more detail.

So, lets start with the basics. What is a gene?
Roll this around a bit before reading on so we can properly air out your preconceived misconceptions.



Genes are discreet ordered sequences of DNA. This DNA is a long polymer made of 4 different chemicals which we can symbolize C,G,A and T. These 4 are the letters of the genetic code. All of the information to construct an organism is contained in this genetic alphabet. A gene is a functional unit of the DNA defined by it's sequence of A,T,C and G. The gene has a code for where it starts and ends. DNA is able to replicate so each cell in an organsim and each individual in a population of organism will inherit a full complement of genes.

Now ask yourself: What do genes do exactly? Think about this mechanistically. The easy answer is: Genes are the vehicle of heredity necessary to build and maintain an organism and it's descendants. But what about the mechanism, how do genes work and what do they really do?

Genes code for proteins. Proteins are made from long polymers of amino acids. It takes three DNA letters to code for a protein. This is the genetic code.



So if you wanted a gene that coded for nothing but poly-tryptophan the gene would look like:
AUGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGGUGA
This codes for: START - (tryptophan)x16 - STOP

In general, this is all genes are and this is all genes do. To a first approximation each individual gene codes for an individual unique protein. Proteins actually do the work of shaping and maintaining organism. You are built of and by proteins. One gene, one protein.

Let me know if any of this is unclear. When you grok the basic principles of molecular biology the rest of your question becomes answerable.







ok I understand the gene sequencing is fairly complicated, I don't see how I'm groking the basic principles of molecular biology, what is groking anyway?


whatever, i'm just trying to understand something. In all this sequencing, when a gene and or protein is put together, it's something not easily done. These codes use molecules, molecules are not easily adapted. The molecular code for dna still involves chemistry and these things and constructed through a process which is pertinent to the last detail of the construction otherwise the molecules won't work together, right?


so when they splice genes, how do they alter the codes? is it as simple as removing and adding the dna to the spot where they want to alter it between the proteins and dna sequences? or do they have to go through a process where the genes become maliable or something, allowing you to manipulate them?


what i'm asking is more pre-genetic engineering, not post-genetic engineering. I'm not looking for what's beyond genetic engineering, i'm looking for how they discovered it and what principles cause some genes to change radically, and some to take millions of years?


where does the glacier begin and end i guess i'm asking. I realize this is a lot of information to explain to someone, if you have links i'd appreciate it if this is just too hard to explain
 
deedle-doo
#5 Posted : 7/14/2008 2:56:12 AM

DMT-Nexus member


Posts: 296
Joined: 25-May-2008
Last visit: 04-Aug-2013
imachavel wrote:


ok I understand the gene sequencing is fairly complicated, I don't see how I'm groking the basic principles of molecular biology, what is groking anyway?


No, it's not. The basics are easy to understand. Grok~understand on a deep, personal level.

imachavel wrote:

whatever, i'm just trying to understand something. In all this sequencing, when a gene and or protein is put together, it's something not easily done. These codes use molecules, molecules are not easily adapted. The molecular code for dna still involves chemistry and these things and constructed through a process which is pertinent to the last detail of the construction otherwise the molecules won't work together, right?


Do not try to think of this as a biochemistry problem. Think of it as an informational problem. We'll call it 'molecular biology' to mark the distinction. DNA can make any protein, even all the proteins necessary to make more DNA.

imachavel wrote:

so when they splice genes, how do they alter the codes? is it as simple as removing and adding the dna to the spot where they want to alter it between the proteins and dna sequences? or do they have to go through a process where the genes become maliable or something, allowing you to manipulate them?


yes it is that simple. In fact, nowadays it is even simpler. You can mail order synthesized sequences of DNA. If you cut them with certain enzymes the ends become 'sticky' you can produce sticky ends on a second piece of DNA with another enzyme and glue them together with the help of a third enzyme. If you can afford it you can order a whole synthesized gene. The chemistry is very very easy and numerous competing companies offer these services.

The next trick is to insert this gene into an organism and get it to make protein. This is very routine in several organisms.


imachavel wrote:

what i'm asking is more pre-genetic engineering, not post-genetic engineering. I'm not looking for what's beyond genetic engineering, i'm looking for how they discovered it and what principles cause some genes to change radically, and some to take millions of years?


The history of molecular biology is very complex and interesting. Check out 'The Eighth Day of Creation' (cold spring harbor press).

imachavel wrote:

where does the glacier begin and end i guess i'm asking. I realize this is a lot of information to explain to someone, if you have links i'd appreciate it if this is just too hard to explain



I enjoy talking about these things above all else. you can read about 'the phage group' or 'molecular biology' on Wikipedia. These entries are pretty good overall.
 
imachavel
#6 Posted : 7/14/2008 4:57:03 AM
DMT-Nexus member


Posts: 177
Joined: 02-Apr-2008
Last visit: 28-Feb-2010
Location: Miami, fl
I see, so they can do just about anything these days

interesting
 
 
Users browsing this forum
Guest (2)

DMT-Nexus theme created by The Traveler
This page was generated in 0.023 seconds.